Biologie 5. Klasse > Zellkern (Nucleus)

Zellkern (Nucleus)

1. Zellkern (Nucleus): Abb. Seite 46 und 47

Zellwand und Zellkern der Zwiebelschuppenzellen

Der Zellkern enthält Erbinformation; Steuerzentrale.
Erbinformation in Form von fadenförmigen Molekülen: Desoxyribonucleinsäure (DNS = DNA).
Die Erbinformation steuert die Bildung von Proteinen (=Eiweißmoleküle). Info = Zusammenbau der Proteine aus den Bausteinen (= Aminosäuren). Es gibt 20 verschiedene Aminosäuren. Proteine sind Aminosäureketten.

Arten von Proteinen: a) Enzyme („Werkzeuge“, Katalysatoren; setzen chemische Veränderungen um), b) Eiweißhormone (Botenstoffe) und c) Strukturproteine (für den Aufbau von Strukturen).

Der Zellkern ist von einer Doppelmembran umgeben. In der Membran befinden sich die Kernporen: Hier kann eine Kopie der Bauanleitung eines Proteins den Kern verlassen.

Die DNA liegt frei im Zellkern = Chromatinmasse. Beim Vorgang der Zellteilung wird jeder DNA-Faden zu einem Chromosom aufgewickelt. Mensch: 46 Chromosomen.

Aufbau der DNA (mit Tafelzeichnung Nucleiotide, Schema aus Buch)

Doppelhelix (= Doppelschraube). Baustein: Nucleotid, bestehend aus dem Zucker Ribose, einer Phosphatgruppe und einer von 4 Basen: Adenin (A), Guanin (G), Cytosin (C) und Thymin (T).
Daher gibt es 4 verschiedene Nucleotide. 2 Nucleotidketten sind über die Basen miteinander verbunden, aber immer nur A mit T und C mit G.

Reihenfolge der Basen = Basensequenz = Code

Gen:
= Bauanleitung für ein Protein. 3 aufeinanderfolgende Basen = Basentriplett = Codon = Codewort für eine Aminosäure. Z.B.: ATACGATCCCGGAATTGTGT (bilde die komplementäre Kette).

Bildungsort der Proteine: Ribosomen (am rauen Endoplasmatischen Reticulum):
Vereinfachter Ablauf:
Bildung einer Arbeitskopie des Gens
Kopie verlässt den Zellkern durch Kernpore und gelangt zum Ribosom
Ablesen der Kopie und Aneinanderreihen von geeigneten Aminosäuren zur Aminosäurekette.
Faltung und Kombinationen mehrerer Ketten zum fertigen Protein.

zurück